Transcript: Human NR_144325.2

Homo sapiens DExH-box helicase 29 (DHX29), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DHX29 (54505)
Length:
4560
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144325.2
NBCI Gene record:
DHX29 (54505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422133 AGTCAGACTTCCTACTAATTA pLKO_005 2097 3UTR 100% 15.000 21.000 N DHX29 n/a
2 TRCN0000416085 TATTGATGGCTGGATCTATTT pLKO_005 3953 3UTR 100% 13.200 18.480 N DHX29 n/a
3 TRCN0000051238 CCTCAAATACAAGCCACTATT pLKO.1 698 3UTR 100% 13.200 10.560 N DHX29 n/a
4 TRCN0000051241 CGTGTACCTTTGGAGGAATTA pLKO.1 3051 3UTR 100% 13.200 10.560 N DHX29 n/a
5 TRCN0000420757 GAAGATACAGTCATGAAATTA pLKO_005 4166 3UTR 100% 15.000 10.500 N DHX29 n/a
6 TRCN0000051240 CCTGGTAGTATGCCCTACAAT pLKO.1 1384 3UTR 100% 5.625 3.938 N DHX29 n/a
7 TRCN0000051239 CCCTGTAAAGATAGCTGTCAT pLKO.1 3980 3UTR 100% 4.950 3.465 N DHX29 n/a
8 TRCN0000051242 CCTAAGTATCAGAAACTTCTA pLKO.1 1799 3UTR 100% 4.950 3.465 N DHX29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08389 pDONR223 100% 83.8% None (many diffs) n/a
2 ccsbBroad304_08389 pLX_304 0% 83.8% V5 (many diffs) n/a
3 TRCN0000466283 ATCAGTCGGTATACTGACAGGAAT pLX_317 8.9% 83.8% V5 (many diffs) n/a
Download CSV