Transcript: Human NR_144412.2

Homo sapiens RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing (RELCH), transcript variant 18, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RELCH (57614)
Length:
8791
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144412.2
NBCI Gene record:
RELCH (57614)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263293 AGGAGTCCTTACGTGTTATAT pLKO_005 2987 3UTR 100% 15.000 21.000 N RELCH n/a
2 TRCN0000216566 GCTATTACAATGGTACTTAAA pLKO.1 4418 3UTR 100% 13.200 10.560 N 2310035C23Rik n/a
3 TRCN0000166882 CCAAAGATATTTGCACTGCTT pLKO.1 4204 3UTR 100% 2.640 2.112 N RELCH n/a
4 TRCN0000263295 AGGCCCTTACACCAATTATAA pLKO_005 1252 3UTR 100% 15.000 10.500 N RELCH n/a
5 TRCN0000282560 ATGGGATGATGTAGGATTAAA pLKO_005 1121 3UTR 100% 15.000 10.500 N RELCH n/a
6 TRCN0000263296 TCAAGATGTGTCCACTATTAT pLKO_005 2633 3UTR 100% 15.000 10.500 N RELCH n/a
7 TRCN0000263294 AGCTATTACAATGGTACTTAA pLKO_005 4417 3UTR 100% 13.200 9.240 N RELCH n/a
8 TRCN0000435486 AGCTATTACAATGGTACTTAA pLKO_005 4417 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
9 TRCN0000166849 CAAAGATATTTGCACTGCTTT pLKO.1 4205 3UTR 100% 4.950 3.465 N RELCH n/a
10 TRCN0000425624 GAGTTTGTTATACCACATTTA pLKO_005 3675 3UTR 100% 13.200 9.240 N 2310035C23Rik n/a
11 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 7587 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144412.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.