Transcript: Human NR_145463.2

Homo sapiens kallikrein related peptidase 13 (KLK13), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
KLK13 (26085)
Length:
1609
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145463.2
NBCI Gene record:
KLK13 (26085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372698 ACTGCCGCACACTGTCTAAAG pLKO_005 242 3UTR 100% 10.800 15.120 N KLK13 n/a
2 TRCN0000046949 GATCCGTGAAACAATCCGAAA pLKO.1 585 3UTR 100% 4.050 5.670 N KLK13 n/a
3 TRCN0000046952 GTCTGTAACAGAACACTGTAT pLKO.1 481 3UTR 100% 4.950 3.960 N KLK13 n/a
4 TRCN0000372699 GGTTGAAGGGCCCACAATAAA pLKO_005 629 3UTR 100% 15.000 10.500 N KLK13 n/a
5 TRCN0000372697 GCTCAATCTCAGCTAACATTC pLKO_005 771 3UTR 100% 10.800 7.560 N KLK13 n/a
6 TRCN0000046950 GCTCAAAGTTTACCTAGGCAA pLKO.1 268 3UTR 100% 2.640 1.848 N KLK13 n/a
7 TRCN0000046948 CCCAGGAAAGATCACTGACAA pLKO.1 393 3UTR 100% 4.950 2.970 N KLK13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02911 pDONR223 100% 34% None 1_25del;321_322ins211;646_1609del n/a
2 ccsbBroad304_02911 pLX_304 0% 34% V5 1_25del;321_322ins211;646_1609del n/a
3 TRCN0000474298 GGTCTTTTAATACGGATCGAGTAT pLX_317 45.9% 34% V5 1_25del;321_322ins211;646_1609del n/a
Download CSV