Transcript: Human NR_145472.2

Homo sapiens sorting nexin 16 (SNX16), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SNX16 (64089)
Length:
3039
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145472.2
NBCI Gene record:
SNX16 (64089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148623 CCAGTCGGTATGCTTTCTAAA pLKO.1 2384 3UTR 100% 13.200 18.480 N SNX16 n/a
2 TRCN0000147926 GCCAAGTTTAATTGGTGGATT pLKO.1 2121 3UTR 100% 4.950 6.930 N SNX16 n/a
3 TRCN0000130391 GCATGTTACTATCTGGGTGAT pLKO.1 1500 3UTR 100% 4.050 5.670 N SNX16 n/a
4 TRCN0000129013 GAAGAGACAAACTACCGCTTA pLKO.1 790 3UTR 100% 4.050 3.240 N SNX16 n/a
5 TRCN0000360088 AGACTCAAATATGGGTAATTT pLKO_005 295 3UTR 100% 15.000 10.500 N SNX16 n/a
6 TRCN0000360146 GTTACTATCTGGGTGATATAT pLKO_005 1504 3UTR 100% 15.000 10.500 N SNX16 n/a
7 TRCN0000360147 TATCTCTGACATGACATATTT pLKO_005 1534 3UTR 100% 15.000 10.500 N SNX16 n/a
8 TRCN0000367939 GACAAGTGTTCCTGATCAAAT pLKO_005 322 3UTR 100% 13.200 9.240 N SNX16 n/a
9 TRCN0000129374 GCAGTGTCTCAACAAGCTCAA pLKO.1 252 3UTR 100% 4.050 2.835 N SNX16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03919 pDONR223 100% 30.9% None 1_160del;770_771ins70;1123_3039del n/a
2 ccsbBroad304_03919 pLX_304 0% 30.9% V5 1_160del;770_771ins70;1123_3039del n/a
3 TRCN0000465499 TGATATCTACTCCAGACAAAGCCG pLX_317 18.5% 30.9% V5 1_160del;770_771ins70;1123_3039del n/a
4 ccsbBroadEn_15131 pDONR223 0% 30.9% None 1_160del;770_771ins70;1123_3039del n/a
5 ccsbBroad304_15131 pLX_304 0% 30.9% V5 1_160del;770_771ins70;1123_3039del n/a
6 TRCN0000473887 ATGCCACCGGACCTGAGAAGATTG pLX_317 41% 30.9% V5 1_160del;770_771ins70;1123_3039del n/a
Download CSV