Transcript: Human NR_145966.2

Homo sapiens DENN domain containing 5A (DENND5A), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
DENND5A (23258)
Length:
4884
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145966.2
NBCI Gene record:
DENND5A (23258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180369 GCGCTTCAACTCCTATGACAT pLKO.1 824 3UTR 100% 4.950 6.930 N DENND5A n/a
2 TRCN0000281013 GCGCTTCAACTCCTATGACAT pLKO_005 824 3UTR 100% 4.950 6.930 N DENND5A n/a
3 TRCN0000150228 GCACAGTTTCACAGAAGTAAA pLKO.1 4646 3UTR 100% 13.200 10.560 N DENND5A n/a
4 TRCN0000297928 GCACAGTTTCACAGAAGTAAA pLKO_005 4646 3UTR 100% 13.200 10.560 N DENND5A n/a
5 TRCN0000181126 CCGTACCACATTCTGATCGTA pLKO.1 3120 3UTR 100% 3.000 2.400 N DENND5A n/a
6 TRCN0000281014 CCGTACCACATTCTGATCGTA pLKO_005 3120 3UTR 100% 3.000 2.400 N DENND5A n/a
7 TRCN0000180294 CCTGCTCTACTCACAGCATTA pLKO.1 1190 3UTR 100% 10.800 7.560 N DENND5A n/a
8 TRCN0000281077 CCTGCTCTACTCACAGCATTA pLKO_005 1190 3UTR 100% 10.800 7.560 N DENND5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11706 pDONR223 100% 50.9% None 1_1502del;3561_3562ins83;4036_4884del n/a
2 ccsbBroad304_11706 pLX_304 0% 50.9% V5 1_1502del;3561_3562ins83;4036_4884del n/a
3 TRCN0000467580 AGCCGGAGACTTCGGGGAAAGCCT pLX_317 15.3% 50.9% V5 1_1502del;3561_3562ins83;4036_4884del n/a
Download CSV