Transcript: Human NR_146056.2

Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC3 (256435)
Length:
6935
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146056.2
NBCI Gene record:
ST6GALNAC3 (256435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035365 GCAAGACAGAAGGGTATAGAA pLKO.1 948 3UTR 100% 5.625 7.875 N ST6GALNAC3 n/a
2 TRCN0000035367 GTTTGCTAAATGGGCCAAGAA pLKO.1 1075 3UTR 100% 4.950 6.930 N ST6GALNAC3 n/a
3 TRCN0000035368 GAACTCACTATGGATACATAA pLKO.1 297 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
4 TRCN0000453943 GAACTCACTATGGATACATAA pLKO_005 297 3UTR 100% 13.200 9.240 N St6galnac3 n/a
5 TRCN0000415633 GATGGTGACTCTGCTAGTAAT pLKO_005 1278 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
6 TRCN0000431259 TGATCTTGCCGCATCACTTAA pLKO_005 1151 3UTR 100% 13.200 9.240 N ST6GALNAC3 n/a
7 TRCN0000035364 GCGTCTTGTAAATGAAGTGAA pLKO.1 196 3UTR 100% 4.950 3.465 N ST6GALNAC3 n/a
8 TRCN0000035366 GCTTCATAGCAGCGTTCCTTT pLKO.1 162 3UTR 100% 4.950 3.465 N ST6GALNAC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09915 pDONR223 100% 13.1% None (many diffs) n/a
2 ccsbBroad304_09915 pLX_304 0% 13.1% V5 (many diffs) n/a
3 TRCN0000471367 GGGACCGATTACGATATGACAAGC pLX_317 44.5% 13.1% V5 (many diffs) n/a
Download CSV