Transcript: Human NR_146068.2

Homo sapiens xylulokinase (XYLB), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
XYLB (9942)
Length:
3081
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146068.2
NBCI Gene record:
XYLB (9942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194902 CGTCATAGGTTTAACACAGAA pLKO.1 1057 3UTR 100% 4.950 6.930 N XYLB n/a
2 TRCN0000037929 CGAGCACTAATTGAAGGACAA pLKO.1 1117 3UTR 100% 4.050 5.670 N XYLB n/a
3 TRCN0000194852 CCGGTGTATGTTATAGACACT pLKO.1 1267 3UTR 100% 2.640 3.696 N XYLB n/a
4 TRCN0000438011 GCAGGCACTGACAAGCTTATC pLKO_005 260 3UTR 100% 10.800 8.640 N XYLB n/a
5 TRCN0000037933 GTTGTGAAGTTAGCTCCAAAT pLKO.1 1366 3UTR 100% 10.800 8.640 N XYLB n/a
6 TRCN0000196999 GTGGAGGTTCGAGCACTAATT pLKO.1 1108 3UTR 100% 13.200 9.240 N XYLB n/a
7 TRCN0000444928 CTCAGTTGTGGGAGCCATTTC pLKO_005 689 3UTR 100% 10.800 7.560 N XYLB n/a
8 TRCN0000440012 TACGTCCAGCGCTACGGATTT pLKO_005 717 3UTR 100% 10.800 7.560 N XYLB n/a
9 TRCN0000037930 GCAGAGTTGAATGTCTTCTAT pLKO.1 163 3UTR 100% 5.625 3.938 N XYLB n/a
10 TRCN0000416217 CCTACTCACATACGGAGAGAA pLKO_005 490 3UTR 100% 4.950 3.465 N XYLB n/a
11 TRCN0000037931 CCTGAAATTATTGGACGTCAT pLKO.1 1042 3UTR 100% 4.050 2.835 N XYLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14948 pDONR223 0% 36.3% None (many diffs) n/a
2 ccsbBroad304_14948 pLX_304 0% 36.3% V5 (many diffs) n/a
3 TRCN0000471651 GACTCCCGATTGTTCTTCAGTTCC pLX_317 31% 36.3% V5 (many diffs) n/a
Download CSV