Construct: ORF TRCN0000471651
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004125.3_s317c1
- Derived from:
- ccsbBroadEn_14948
- DNA Barcode:
- GACTCCCGATTGTTCTTCAGTTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- XYLB (9942)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471651
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9942 | XYLB | xylulokinase | XM_017007599.2 | 92.5% | 88.3% | (many diffs) |
| 2 | human | 9942 | XYLB | xylulokinase | XM_011534330.3 | 87.8% | 86.8% | (many diffs) |
| 3 | human | 9942 | XYLB | xylulokinase | NM_005108.4 | 85.8% | 84.8% | (many diffs) |
| 4 | human | 9942 | XYLB | xylulokinase | XR_001740393.2 | 85.4% | (many diffs) | |
| 5 | human | 9942 | XYLB | xylulokinase | XM_011534329.2 | 85.2% | 84.2% | (many diffs) |
| 6 | human | 9942 | XYLB | xylulokinase | XR_001740394.2 | 82.6% | (many diffs) | |
| 7 | human | 9942 | XYLB | xylulokinase | NM_001349178.2 | 81.9% | 80.9% | (many diffs) |
| 8 | human | 9942 | XYLB | xylulokinase | XM_011534328.3 | 79.3% | 78.4% | (many diffs) |
| 9 | human | 9942 | XYLB | xylulokinase | XM_011534327.2 | 78.6% | 77.7% | (many diffs) |
| 10 | human | 9942 | XYLB | xylulokinase | XM_024453850.1 | 73.6% | 72.5% | (many diffs) |
| 11 | human | 9942 | XYLB | xylulokinase | NM_001349179.1 | 60.5% | 59.5% | (many diffs) |
| 12 | human | 9942 | XYLB | xylulokinase | XM_011534325.3 | 55.9% | 55.2% | (many diffs) |
| 13 | human | 9942 | XYLB | xylulokinase | XM_017007596.1 | 47.9% | 47.2% | (many diffs) |
| 14 | human | 9942 | XYLB | xylulokinase | XM_017007595.1 | 39.4% | 38.7% | (many diffs) |
| 15 | human | 9942 | XYLB | xylulokinase | NR_146068.2 | 36.3% | (many diffs) | |
| 16 | human | 9942 | XYLB | xylulokinase | XM_017007597.1 | 27.2% | 20.3% | (many diffs) |
| 17 | human | 9942 | XYLB | xylulokinase | NM_001349180.2 | 12.8% | 11.2% | (many diffs) |
| 18 | mouse | 102448 | Xylb | xylulokinase homolog (H. in... | NM_001033209.3 | 72.6% | 73.8% | (many diffs) |
| 19 | mouse | 102448 | Xylb | xylulokinase homolog (H. in... | XM_006511908.3 | 61.9% | 62.6% | (many diffs) |
| 20 | mouse | 102448 | Xylb | xylulokinase homolog (H. in... | XM_011242927.2 | 61.9% | 62.6% | (many diffs) |
| 21 | mouse | 102448 | Xylb | xylulokinase homolog (H. in... | NM_001199568.1 | 40% | 39.7% | (many diffs) |
| 22 | mouse | 102448 | Xylb | xylulokinase homolog (H. in... | XM_017313063.1 | 40% | 39.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1452
- ORF length:
- 1386
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggagcacgcc cctcgccgct gctgcctggg ctgggacttc agcacgcagc 121 aggtaaaggt tgttgctgtt gatgcagagt tgaatgtctt ctatgaggaa agtgtgcatt 181 ttgacagaga tcttccagaa tttgggactc agggcggtgt tcatgtgcac aaggatgggc 241 tgacggtcac ttctccagta ctaatgtggg tccaggcact ggatatcatc ttggagaaga 301 tgaaggcttc gggcttcgaa ttctctcaag tcctagcctt gtccggggcg ggccagcaac 361 acggaagtat atactggaag gctggagccc agcaggcact gacaagctta tcaccagacc 421 tccggctaca ccagcagctt caggactgtt tttccatcag cgactgcccg gtgtggatgg 481 actccagcac cacagcccag tgccgccagc tggaggctgc tgtgggtggt gctcaggctc 541 tcagctgcct cacggggtcc cgtgcctatg agcgttttac agggaaccaa attgcaaaaa 601 tttaccagca gaaccccgag gcctactcac atacagagag aatttctttg gtcagtagct 661 ttgctgcttc cctgttcctt ggctcttact cccctattga ctacagtgat ggttctggaa 721 tgaatttgtt gcagatacag gataaagtct ggtcccaggc ttgccttggt gcctgtgcac 781 ctcatttaga ggagaagctt agcccaccag taccatcatg ctcagttgtg ggagccattt 841 cttcctacta cgtccagcgc tacggatttc ctccaggatg caaagtggtg gccttcactg 901 gggacaaccc agcgtcgctg gcaggcatga gactggagga aggtgacatt gcggtcagcc 961 tgggcaccag tgacaccctg tttctctggc tccaagagcc catgcctgcc ctggaaggcc 1021 acatcTTCTG CAACCCGGTT GACTCCCAGC ACTACATGGC ACTCCTGTGC TTTAAAAATG 1081 GCTCCCTCAT GAGAGAGAAG ATCCGCAACG AGTCTGTATC CCGTTCCTGG AGCGATTTCT 1141 CTAAGGCACT GCAGTCCACA GAGATGGGCA ACGGTGGAAA CCTGGGTTTT TATTTTGATG 1201 TAATGGAGAT CACCCCTGAA ATTATTGGAC GTCATAGGTT TAACACAGAA AACCACAAGG 1261 TTGCAGCATT CCCTGGGGAT GTGGAGGTTC GAGCACTAAT TGAAGGACAA TTCATGGCCA 1321 AGAGGATTCA CGCAGAAGGC CTGGGCTATC GAGTCATGTC CAAGACAAAG ATTTTGGCCA 1381 CAGGAGGAGC ATCTCACAAT AGAGAAATCT TACAGGTGCT TGCAGATGTG TTGATGCCCC 1441 GGTGTATGTT ATACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1561 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGAC TCCCGATTGT TCTTCAGTTC 1621 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t