Transcript: Human NR_146190.1

Homo sapiens family with sequence similarity 185 member B, pseudogene (FAM185BP), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
FAM185BP (641808)
Length:
3471
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146190.1
NBCI Gene record:
FAM185BP (641808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165245 GATGGCCATTGTGTCTGATAC pLKO.1 557 3UTR 100% 10.800 5.400 Y FAM185A n/a
2 TRCN0000163006 GCCATTGTGTCTGATACTATC pLKO.1 561 3UTR 100% 10.800 5.400 Y FAM185A n/a
3 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3209 3UTR 100% 4.950 2.475 Y ERAP2 n/a
4 TRCN0000165521 GAGATGGCCATTGTGTCTGAT pLKO.1 555 3UTR 100% 4.950 2.475 Y FAM185A n/a
5 TRCN0000159862 GCCAAGTATCTTTATACAGAA pLKO.1 894 3UTR 100% 4.950 2.475 Y FAM185A n/a
6 TRCN0000164287 CCATCTTCACTTCAAGCTCAT pLKO.1 1125 3UTR 100% 4.050 2.025 Y FAM185A n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3210 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13434 pDONR223 100% 12.2% None (many diffs) n/a
2 ccsbBroad304_13434 pLX_304 0% 12.2% V5 (many diffs) n/a
Download CSV