Transcript: Human NR_146218.2

Homo sapiens COMM domain containing 10 (COMMD10), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
COMMD10 (51397)
Length:
5296
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146218.2
NBCI Gene record:
COMMD10 (51397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167333 CACCTAGTTCTTGAAACAATA pLKO.1 233 3UTR 100% 13.200 18.480 N COMMD10 n/a
2 TRCN0000166847 CAGCAGCAATTAGAGAACATT pLKO.1 305 3UTR 100% 5.625 3.938 N COMMD10 n/a
3 TRCN0000168445 GAGAGCAGTTTCAGTGAAGAA pLKO.1 164 3UTR 100% 4.950 3.465 N COMMD10 n/a
4 TRCN0000280882 GAGAGCAGTTTCAGTGAAGAA pLKO_005 164 3UTR 100% 4.950 3.465 N COMMD10 n/a
5 TRCN0000168651 GCAGCAGCAATTAGAGAACAT pLKO.1 304 3UTR 100% 4.950 3.465 N COMMD10 n/a
6 TRCN0000280881 GCAGCAGCAATTAGAGAACAT pLKO_005 304 3UTR 100% 4.950 3.465 N COMMD10 n/a
7 TRCN0000168560 GCAGTGTCACTGATAAATGCA pLKO.1 80 3UTR 100% 3.000 2.100 N COMMD10 n/a
8 TRCN0000280883 GCAGTGTCACTGATAAATGCA pLKO_005 80 3UTR 100% 3.000 2.100 N COMMD10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08286 pDONR223 100% 10.8% None (many diffs) n/a
2 ccsbBroad304_08286 pLX_304 0% 10.8% V5 (many diffs) n/a
3 TRCN0000475125 TGGCCTCAAACAAGCTGAAAATGT pLX_317 70.9% 10.8% V5 (many diffs) n/a
Download CSV