Transcript: Human NR_146514.2

Homo sapiens N-deacetylase and N-sulfotransferase 3 (NDST3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NDST3 (9348)
Length:
5762
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146514.2
NBCI Gene record:
NDST3 (9348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427530 ATCGAAGCCTTCTAGATAAAT pLKO_005 699 3UTR 100% 15.000 21.000 N NDST3 n/a
2 TRCN0000035993 CGTTTGATTCTCATAAAGGTT pLKO.1 2617 3UTR 100% 3.000 4.200 N NDST3 n/a
3 TRCN0000035992 GCGTGCACAAATCACAAATTT pLKO.1 1270 3UTR 100% 15.000 12.000 N NDST3 n/a
4 TRCN0000035990 CCCATTTCAGTTGCTAATTAT pLKO.1 2498 3UTR 100% 15.000 10.500 N NDST3 n/a
5 TRCN0000415588 GACCTCCAACACCTACCATAT pLKO_005 422 3UTR 100% 10.800 7.560 N NDST3 n/a
6 TRCN0000035989 CCCACAGTCCTAGTATTTGTA pLKO.1 494 3UTR 100% 5.625 3.938 N NDST3 n/a
7 TRCN0000035991 GCTTTGTATTTGTTCCTGGTT pLKO.1 2090 3UTR 100% 2.640 1.848 N NDST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146514.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07396 pDONR223 100% 44.3% None (many diffs) n/a
2 ccsbBroad304_07396 pLX_304 0% 44.3% V5 (many diffs) n/a
3 TRCN0000491282 ACGTAGTCCTAAACAGAATCCTGA pLX_317 10.9% 44.3% V5 (many diffs) n/a
Download CSV