Transcript: Human NR_146876.1

Homo sapiens WD repeat domain 27 (WDR27), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
WDR27 (253769)
Length:
2708
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146876.1
NBCI Gene record:
WDR27 (253769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146876.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121532 CTGGATATTGAGCAGCGATTT pLKO.1 1147 3UTR 100% 10.800 15.120 N WDR27 n/a
2 TRCN0000144600 GATGTTAATAACCGCCACAAA pLKO.1 1192 3UTR 100% 4.950 6.930 N WDR27 n/a
3 TRCN0000425437 AGTGGGCTTATTCGTATTTAA pLKO_005 2086 3UTR 100% 15.000 10.500 N WDR27 n/a
4 TRCN0000144221 CAGTGGGCTTATTCGTATTTA pLKO.1 2085 3UTR 100% 15.000 10.500 N WDR27 n/a
5 TRCN0000417919 GAGCAGGTTGAAGTAACATTT pLKO_005 1964 3UTR 100% 13.200 9.240 N WDR27 n/a
6 TRCN0000121951 CTGCTTTGTATTACAAGGATT pLKO.1 2130 3UTR 100% 4.950 3.465 N WDR27 n/a
7 TRCN0000144265 CTGGATGAATGTAGAGAGAAA pLKO.1 1003 3UTR 100% 4.950 3.465 N WDR27 n/a
8 TRCN0000145527 GCTGCTTTGTATTACAAGGAT pLKO.1 2129 3UTR 100% 3.000 2.100 N WDR27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146876.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13452 pDONR223 100% 33.8% None (many diffs) n/a
2 ccsbBroad304_13452 pLX_304 0% 33.8% V5 (many diffs) n/a
3 TRCN0000475194 CTACGGATGGCCGCCCGCTAGTGC pLX_317 15% 33.8% V5 (many diffs) n/a
Download CSV