Transcript: Human NR_146893.2

Homo sapiens ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 (ARAP2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
ARAP2 (116984)
Length:
7557
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146893.2
NBCI Gene record:
ARAP2 (116984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435812 GGAACCCGACTGTAGTATTAT pLKO_005 4501 3UTR 100% 15.000 21.000 N ARAP2 n/a
2 TRCN0000149503 GCTATCATTGAACACCTGTAT pLKO.1 4214 3UTR 100% 4.950 6.930 N ARAP2 n/a
3 TRCN0000418014 CATCTGCAAAGAAGGTTAAAT pLKO_005 1926 3UTR 100% 15.000 10.500 N ARAP2 n/a
4 TRCN0000432416 TCACCGTAGGAGGATACTTAA pLKO_005 655 3UTR 100% 13.200 9.240 N ARAP2 n/a
5 TRCN0000182989 CATCTAAATCTAGGACTCAAA pLKO.1 1785 3UTR 100% 4.950 3.465 N ARAP2 n/a
6 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 6020 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.