Transcript: Human NR_146978.1

Homo sapiens family with sequence similarity 185 member A (FAM185A), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
FAM185A (222234)
Length:
1785
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146978.1
NBCI Gene record:
FAM185A (222234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164171 CCACTCAAGGAAAGGAGATTA pLKO.1 1625 3UTR 100% 13.200 9.240 N FAM185A n/a
2 TRCN0000166552 CCCACTCAAGGAAAGGAGATT pLKO.1 1624 3UTR 100% 4.950 3.465 N FAM185A n/a
3 TRCN0000163185 GCTGAGTTCTTCTCATGCTTT pLKO.1 1454 3UTR 100% 4.950 3.465 N FAM185A n/a
4 TRCN0000158865 GCTTTGAATATCTGACTTCTT pLKO.1 1470 3UTR 100% 4.950 2.970 N FAM185A n/a
5 TRCN0000164287 CCATCTTCACTTCAAGCTCAT pLKO.1 735 3UTR 100% 4.050 2.025 Y FAM185A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13434 pDONR223 100% 18% None (many diffs) n/a
2 ccsbBroad304_13434 pLX_304 0% 18% V5 (many diffs) n/a
Download CSV