Transcript: Human NR_147088.2

Homo sapiens KIAA0753 (KIAA0753), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
KIAA0753 (9851)
Length:
4754
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147088.2
NBCI Gene record:
KIAA0753 (9851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147088.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445490 GCAACTTGGCGATCCGATATT pLKO_005 277 3UTR 100% 13.200 18.480 N KIAA0753 n/a
2 TRCN0000167098 CCTGATGTGGTTATAGATATT pLKO.1 1549 3UTR 100% 13.200 9.240 N KIAA0753 n/a
3 TRCN0000167045 CTGCAGTTTAATAGGAATGTT pLKO.1 243 3UTR 100% 5.625 3.938 N KIAA0753 n/a
4 TRCN0000172574 GAGCAGTACCTTCGGATCATA pLKO.1 2969 3UTR 100% 5.625 3.938 N KIAA0753 n/a
5 TRCN0000172929 GCCGAATGGAAGAGATGGAAA pLKO.1 2589 3UTR 100% 4.950 3.465 N KIAA0753 n/a
6 TRCN0000167260 CGTATATTTCACACAAGGATT pLKO.1 3499 3UTR 100% 4.950 2.970 N KIAA0753 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147088.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467160 CAGGGACTCGGCCGAGGACCGGCT pLX_317 14.2% 53.2% V5 (many diffs) n/a
Download CSV