Transcript: Human NR_148012.2

Homo sapiens tubulin tyrosine ligase like 9 (TTLL9), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
TTLL9 (164395)
Length:
2746
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148012.2
NBCI Gene record:
TTLL9 (164395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180032 CCCTTGCTTTCCTCACTTGAT pLKO.1 2328 3UTR 100% 4.950 3.465 N TTLL9 n/a
2 TRCN0000149608 GAAGGTGATCATCAGTGACAA pLKO.1 1226 3UTR 100% 4.950 3.465 N TTLL9 n/a
3 TRCN0000148520 CCATGGATTGTCAAAGGGAAA pLKO.1 338 3UTR 100% 4.050 2.835 N TTLL9 n/a
4 TRCN0000147563 GCCTGTGTTTCTATGTAACTA pLKO.1 2537 3UTR 100% 5.625 3.375 N TTLL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13339 pDONR223 100% 25.1% None (many diffs) n/a
2 ccsbBroad304_13339 pLX_304 0% 25.1% V5 (many diffs) n/a
3 TRCN0000472304 ATGATCTGCCCAAGATAGAGCTCG pLX_317 70.4% 25.1% V5 (many diffs) n/a
Download CSV