Transcript: Human NR_148714.2

Homo sapiens zinc finger DHHC-type containing 21 (ZDHHC21), transcript variant 15, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
ZDHHC21 (340481)
Length:
9103
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148714.2
NBCI Gene record:
ZDHHC21 (340481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142952 CCACTTTGCCAATCATGTCTA pLKO.1 1187 3UTR 100% 4.950 6.930 N ZDHHC21 n/a
2 TRCN0000278259 CCACTTTGCCAATCATGTCTA pLKO_005 1187 3UTR 100% 4.950 6.930 N ZDHHC21 n/a
3 TRCN0000139354 CCTCCATAACTGATCCAGGAA pLKO.1 459 3UTR 100% 2.640 3.696 N ZDHHC21 n/a
4 TRCN0000143565 GAAAGGGAGTTCTGGGAATTA pLKO.1 512 3UTR 100% 13.200 9.240 N ZDHHC21 n/a
5 TRCN0000278260 GAAAGGGAGTTCTGGGAATTA pLKO_005 512 3UTR 100% 13.200 9.240 N ZDHHC21 n/a
6 TRCN0000140807 GCAGCCTTTATGGGCATTACT pLKO.1 806 3UTR 100% 5.625 3.938 N ZDHHC21 n/a
7 TRCN0000144923 GTTGGAATAACTGGACTCTTT pLKO.1 833 3UTR 100% 4.950 3.465 N ZDHHC21 n/a
8 TRCN0000297428 GTTGGAATAACTGGACTCTTT pLKO_005 833 3UTR 100% 4.950 3.465 N ZDHHC21 n/a
9 TRCN0000143485 GAAGGACATATTCCAGGCATA pLKO.1 383 3UTR 100% 4.050 2.835 N ZDHHC21 n/a
10 TRCN0000278261 GAAGGACATATTCCAGGCATA pLKO_005 383 3UTR 100% 4.050 2.835 N ZDHHC21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10027 pDONR223 100% 8.2% None (many diffs) n/a
Download CSV