Transcript: Human NR_148914.2

Homo sapiens NADH:ubiquinone oxidoreductase complex assembly factor 6 (NDUFAF6), transcript variant 33, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NDUFAF6 (137682)
Length:
3692
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148914.2
NBCI Gene record:
NDUFAF6 (137682)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322613 ACGGGATTATGAAGGTTATTT pLKO_005 221 3UTR 100% 15.000 21.000 N NDUFAF6 n/a
2 TRCN0000322686 CACTAGAAATATTGGGTATAA pLKO_005 783 3UTR 100% 13.200 18.480 N NDUFAF6 n/a
3 TRCN0000131062 CAGAATCCCGAAGCTCTGTTT pLKO.1 262 3UTR 100% 4.950 6.930 N NDUFAF6 n/a
4 TRCN0000322611 CAGAATCCCGAAGCTCTGTTT pLKO_005 262 3UTR 100% 4.950 6.930 N NDUFAF6 n/a
5 TRCN0000147827 GAAACGGGATTATGAAGGTTA pLKO.1 218 3UTR 100% 4.950 6.930 N NDUFAF6 n/a
6 TRCN0000322680 TGACAAAGCATATCGTAATAT pLKO_005 709 3UTR 100% 15.000 10.500 N NDUFAF6 n/a
7 TRCN0000267016 TCTACGGAGGAACCAAGATAA pLKO_005 955 3UTR 100% 13.200 9.240 N Ndufaf6 n/a
8 TRCN0000149850 CTTTAATGTGGAACTGGCTCA pLKO.1 296 3UTR 100% 2.160 1.512 N NDUFAF6 n/a
9 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 1673 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15248 pDONR223 87.6% 9.4% None (many diffs) n/a
2 ccsbBroad304_15248 pLX_304 0% 9.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV