Transcript: Mouse NR_149827.1

Mus musculus heterogeneous nuclear ribonucleoprotein U (Hnrnpu), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpu (51810)
Length:
4909
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149827.1
NBCI Gene record:
Hnrnpu (51810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_149827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340673 GGGAATCGTGGTGGATATAAT pLKO_005 2345 3UTR 100% 15.000 21.000 N Hnrnpu n/a
2 TRCN0000340672 AGATCATGGCCGAGGGTATTT pLKO_005 925 3UTR 100% 13.200 18.480 N Hnrnpu n/a
3 TRCN0000120021 GCAATAAGAATAAGAGTGGCA pLKO.1 2241 3UTR 100% 0.660 0.924 N Hnrnpu n/a
4 TRCN0000120019 CCATAACTGTGCAGTTGAATT pLKO.1 1522 3UTR 100% 0.000 0.000 N Hnrnpu n/a
5 TRCN0000340670 CCATAACTGTGCAGTTGAATT pLKO_005 1522 3UTR 100% 0.000 0.000 N Hnrnpu n/a
6 TRCN0000340593 TGCCCGTAAGAAGCGAAATTT pLKO_005 1882 3UTR 100% 15.000 10.500 N Hnrnpu n/a
7 TRCN0000120020 CAGTGGTTTGTCTTGATACTT pLKO.1 1029 3UTR 100% 5.625 3.938 N Hnrnpu n/a
8 TRCN0000120017 CCTGGGAAATACAACATTCTT pLKO.1 1736 3UTR 100% 5.625 3.938 N Hnrnpu n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468483 AAGCTCTTCGCTAGCGTTAGCACT pLX_317 16.3% 38.9% V5 (many diffs) n/a
Download CSV