Transcript: Human NR_157175.2

Homo sapiens 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), transcript variant 16, non-coding RNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MTRR (4552)
Length:
3397
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_157175.2
NBCI Gene record:
MTRR (4552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_157175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416700 GTTACTGGGTCTCGGTGATTC pLKO_005 369 3UTR 100% 10.800 15.120 N MTRR n/a
2 TRCN0000035405 GCCGATTATAGCCGCTTTGTA pLKO.1 1324 3UTR 100% 5.625 7.875 N MTRR n/a
3 TRCN0000433695 ACTTCAACCCAGACCATATTC pLKO_005 1586 3UTR 100% 13.200 10.560 N MTRR n/a
4 TRCN0000035406 GCAGGCATAAGGATAGGGATT pLKO.1 1984 3UTR 100% 4.050 3.240 N MTRR n/a
5 TRCN0000035407 GCAGAGGACAAGAGGAGATAA pLKO.1 563 3UTR 100% 13.200 9.240 N MTRR n/a
6 TRCN0000035404 CCCGCAAGTTTGTTAAGGAAA pLKO.1 299 3UTR 100% 4.950 3.465 N MTRR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_157175.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15502 pDONR223 0% 61.6% None 1_93del;1420_1571del;2340_3397del n/a
2 ccsbBroad304_15502 pLX_304 0% 61.6% V5 1_93del;1420_1571del;2340_3397del n/a
Download CSV