Transcript: Human NR_160271.1

Homo sapiens zinc finger protein 138 (ZNF138), transcript variant 19, non-coding RNA.

Source:
NCBI, updated 2018-12-08
Taxon:
Homo sapiens (human)
Gene:
ZNF138 (7697)
Length:
2433
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160271.1
NBCI Gene record:
ZNF138 (7697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429634 TAACAACTTACTGAACATAAG pLKO_005 953 3UTR 100% 10.800 7.560 N ZNF138 n/a
2 TRCN0000012919 CTGGTCCACAAACCTTTCTAA pLKO.1 610 3UTR 100% 5.625 3.938 N ZNF138 n/a
3 TRCN0000012922 CACAAACCTTTCTAAACCTAA pLKO.1 616 3UTR 100% 4.950 3.465 N ZNF138 n/a
4 TRCN0000421902 ACAATGTGGCAAGGTCTTTAA pLKO_005 841 3UTR 100% 13.200 7.920 N ZNF138 n/a
5 TRCN0000434325 ACACTGTGGCAAAGCCTTTAA pLKO_005 757 3UTR 100% 13.200 7.920 N ZNF138 n/a
6 TRCN0000424428 ACCTTACTAGACATAAGATAA pLKO_005 789 3UTR 100% 13.200 7.920 N ZNF138 n/a
7 TRCN0000413885 AGCTCACTGAACATAAGTTAA pLKO_005 1125 3UTR 100% 13.200 7.920 N ZNF138 n/a
8 TRCN0000417549 CAATCCTCAATCCTTACTAAA pLKO_005 695 3UTR 100% 13.200 7.920 N ZNF138 n/a
9 TRCN0000012920 CCCTTACTAAACATCAGATAA pLKO.1 873 3UTR 100% 13.200 7.920 N ZNF138 n/a
10 TRCN0000422662 TTCACGCCTAACTCAACATAA pLKO_005 532 3UTR 100% 13.200 7.920 N ZNF138 n/a
11 TRCN0000420316 AGAATGTGACAAATCACTTTG pLKO_005 505 3UTR 100% 10.800 6.480 N ZNF138 n/a
12 TRCN0000012918 CCTCAACTCTTATTACACATA pLKO.1 1287 3UTR 100% 4.950 2.970 N ZNF138 n/a
13 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 816 3UTR 100% 13.200 6.600 Y ZNF138 n/a
14 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2201 3UTR 100% 5.625 2.813 Y ZNF254 n/a
15 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 783 3UTR 100% 4.950 2.475 Y ZNF681 n/a
16 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1493 3UTR 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11235 pDONR223 100% 21.2% None 1_436del;953_2433del n/a
2 ccsbBroad304_11235 pLX_304 0% 21.2% V5 1_436del;953_2433del n/a
3 TRCN0000481650 TTTATCAAAGGAATCCCCAATTTT pLX_317 100% 21.2% V5 1_436del;953_2433del n/a
Download CSV