Transcript: Human NR_160672.1

Homo sapiens uncharacterized LOC101927245 (LOC101927245), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-01-29
Taxon:
Homo sapiens (human)
Gene:
LOC101927245 (101927245)
Length:
1950
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160672.1
NBCI Gene record:
LOC101927245 (101927245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1883 3UTR 100% 5.625 2.813 Y KLHL30 n/a
2 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1883 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15487 pDONR223 0% 8.2% None (many diffs) n/a
2 ccsbBroad304_15487 pLX_304 0% 8.2% V5 (many diffs) n/a
3 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 8.2% V5 (many diffs) n/a
Download CSV