Transcript: Human NR_160918.1

Homo sapiens bromodomain and PHD finger containing 1 (BRPF1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
BRPF1 (7862)
Length:
4912
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160918.1
NBCI Gene record:
BRPF1 (7862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021909 CCAATGGACTTACCAGCCAAT pLKO.1 3497 3UTR 100% 4.050 5.670 N BRPF1 n/a
2 TRCN0000364129 CGTACTTTGAGAGTCATAATA pLKO_005 1181 3UTR 100% 15.000 12.000 N BRPF1 n/a
3 TRCN0000358930 GATAAGAACTGGGCCCTTAAA pLKO_005 2149 3UTR 100% 13.200 10.560 N BRPF1 n/a
4 TRCN0000021913 CCACCACACAGGCTTAGTAAA pLKO.1 1963 3UTR 100% 13.200 9.240 N BRPF1 n/a
5 TRCN0000416258 GGCTTACCGCTACCTGAATTT pLKO_005 2653 3UTR 100% 13.200 9.240 N BRPF1 n/a
6 TRCN0000429455 AGTTTCTTGGTATACCGTAAT pLKO_005 3551 3UTR 100% 10.800 7.560 N BRPF1 n/a
7 TRCN0000364128 TGCCGAGGCTATCCATCATAC pLKO_005 3878 3UTR 100% 10.800 7.560 N BRPF1 n/a
8 TRCN0000422351 ATGCCAGGAGAATCCATAACT pLKO_005 4575 3UTR 100% 5.625 3.938 N BRPF1 n/a
9 TRCN0000021910 CCGAAAGGTCTACAAGAGTTA pLKO.1 498 3UTR 100% 4.950 3.465 N BRPF1 n/a
10 TRCN0000021912 CCGCATCAGCATCTTTGACAA pLKO.1 738 3UTR 100% 4.950 3.465 N BRPF1 n/a
11 TRCN0000426275 CTCATTTGTAACTGCGTTTCC pLKO_005 4724 3UTR 100% 4.050 2.835 N BRPF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07183 pDONR223 100% 74.2% None (many diffs) n/a
2 ccsbBroad304_07183 pLX_304 0% 74.2% V5 (many diffs) n/a
3 TRCN0000491700 CTATGCAAATAGTTGCACTTATTA pLX_317 9.4% 74.2% V5 (many diffs) n/a
Download CSV