Transcript: Human NR_161251.1

Homo sapiens chromosome 5 open reading frame 64 (C5orf64), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-03-29
Taxon:
Homo sapiens (human)
Gene:
C5orf64 (285668)
Length:
3019
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161251.1
NBCI Gene record:
C5orf64 (285668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148071 GTTAGCTGACTGTGTTCTAAA pLKO.1 460 3UTR 100% 13.200 10.560 N C5orf64 n/a
2 TRCN0000129934 GCAAGGTAATCAAGTCCATAA pLKO.1 634 3UTR 100% 10.800 7.560 N C5orf64 n/a
3 TRCN0000146701 CCTTCAATCAAATCGAGATCA pLKO.1 308 3UTR 100% 4.950 3.465 N C5orf64 n/a
4 TRCN0000148390 CTCCTCAATTAGGCAGAACAA pLKO.1 189 3UTR 100% 4.950 3.465 N C5orf64 n/a
5 TRCN0000149242 GAGACAGAGTTCAAGCAGAAT pLKO.1 245 3UTR 100% 4.950 3.465 N C5orf64 n/a
6 TRCN0000149070 GATCACATCTTCCTGCAGTTT pLKO.1 324 3UTR 100% 4.950 3.465 N C5orf64 n/a
7 TRCN0000147559 GCAGCTTCTATACTTGACATA pLKO.1 1950 3UTR 100% 4.950 3.465 N C5orf64 n/a
8 TRCN0000128832 GAGACAAATAGAGGAACGGAA pLKO.1 409 3UTR 100% 2.640 1.848 N C5orf64 n/a
9 TRCN0000149018 GCAGAGAGACAAATAGAGGAA pLKO.1 404 3UTR 100% 2.640 1.848 N C5orf64 n/a
10 TRCN0000130393 GCTGAAGTTTACTTCCCTTCA pLKO.1 293 3UTR 100% 0.405 0.284 N C5orf64 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1457 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1457 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13555 pDONR223 100% 12.8% None (many diffs) n/a
2 ccsbBroad304_13555 pLX_304 0% 12.8% V5 (many diffs) n/a
3 TRCN0000481099 TTGTAGGTATAGCCTCCTCCCGCG pLX_317 100% 12.8% V5 (many diffs) n/a
Download CSV