Transcript: Human NR_161470.1

Homo sapiens NFKB inhibitor beta (NFKBIB), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-04-16
Taxon:
Homo sapiens (human)
Gene:
NFKBIB (4793)
Length:
934
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161470.1
NBCI Gene record:
NFKBIB (4793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018558 GAATACGACGACATTGTGGTT pLKO.1 779 3UTR 100% 2.640 3.696 N NFKBIB n/a
2 TRCN0000275156 TACTCCCGACACCAACCATAC pLKO_005 399 3UTR 100% 6.000 4.800 N NFKBIB n/a
3 TRCN0000018556 GCTGTGATTCATCAGCATGAA pLKO.1 88 3UTR 100% 0.495 0.347 N NFKBIB n/a
4 TRCN0000275102 GCTGTGATTCATCAGCATGAA pLKO_005 88 3UTR 100% 0.495 0.347 N NFKBIB n/a
5 TRCN0000018559 CGACTTGGAGAAGGAAGAAGA pLKO.1 444 3UTR 100% 4.950 2.970 N NFKBIB n/a
6 TRCN0000318914 CGACTTGGAGAAGGAAGAAGA pLKO_005 444 3UTR 100% 4.950 2.970 N NFKBIB n/a
7 TRCN0000275104 TGGACCTGCAGAATGACCTAG pLKO_005 155 3UTR 100% 4.050 2.430 N NFKBIB n/a
8 TRCN0000018560 GCAGCCGATGTGCTGGAGCTT pLKO.1 563 3UTR 100% 0.000 0.000 N NFKBIB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01094 pDONR223 100% 74.4% None (many diffs) n/a
2 ccsbBroad304_01094 pLX_304 53% 74.4% V5 (many diffs) n/a
3 TRCN0000471386 TAAACTCTGGATCGGATTACCTCC pLX_317 45.1% 74.4% V5 (many diffs) n/a
Download CSV