Transcript: Human NR_163135.1

Homo sapiens ATP synthase membrane subunit c locus 2 (ATP5MC2), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-04-17
Taxon:
Homo sapiens (human)
Gene:
ATP5MC2 (517)
Length:
798
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163135.1
NBCI Gene record:
ATP5MC2 (517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369757 GTTCGCCTGCTCCAAGTTTGT pLKO_005 65 3UTR 100% 4.950 6.930 N ATP5MC2 n/a
2 TRCN0000043490 CGACCGGAGATACTGACAGAT pLKO.1 322 3UTR 100% 4.950 3.960 N ATP5MC2 n/a
3 TRCN0000333326 CGACCGGAGATACTGACAGAT pLKO_005 322 3UTR 100% 4.950 3.960 N ATP5MC2 n/a
4 TRCN0000043491 GCTTCCAAACCAGCGCCATTT pLKO.1 401 3UTR 100% 10.800 7.560 N ATP5MC2 n/a
5 TRCN0000333328 GCTTCCAAACCAGCGCCATTT pLKO_005 401 3UTR 100% 10.800 7.560 N ATP5MC2 n/a
6 TRCN0000043488 CCCTTACCTCACTTGTCTCTA pLKO.1 374 3UTR 100% 4.950 3.465 N ATP5MC2 n/a
7 TRCN0000333327 CCCTTACCTCACTTGTCTCTA pLKO_005 374 3UTR 100% 4.950 3.465 N ATP5MC2 n/a
8 TRCN0000043489 GTAGCCTTTCTCATCCTCTTT pLKO.1 625 3UTR 100% 4.950 3.465 N ATP5MC2 n/a
9 TRCN0000363678 GTAGCCTTTCTCATCCTCTTT pLKO_005 625 3UTR 100% 4.950 3.465 N ATP5MC2 n/a
10 TRCN0000043492 AGGAACCCTTCTCTGAAGCAA pLKO.1 538 3UTR 100% 3.000 2.100 N ATP5MC2 n/a
11 TRCN0000297024 ACACAGCAGCCAAGTTCATTG pLKO_005 434 3UTR 100% 10.800 6.480 N Gm10039 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.