Transcript: Human NR_163926.1

Homo sapiens B cell receptor associated protein 29 (BCAP29), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
BCAP29 (55973)
Length:
2656
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163926.1
NBCI Gene record:
BCAP29 (55973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365011 GACGTCTGGTTACGCTTATTA pLKO_005 423 3UTR 100% 15.000 7.500 Y BCAP29 n/a
2 TRCN0000364977 ATGCCGAAATAGGACTCATTT pLKO_005 108 3UTR 100% 13.200 6.600 Y BCAP29 n/a
3 TRCN0000376604 CAAGGCTTTCCTTACCATTAT pLKO_005 217 3UTR 100% 13.200 6.600 Y BCAP29 n/a
4 TRCN0000369966 GTCAAACAAAGGTGTACTTAA pLKO_005 463 3UTR 100% 13.200 6.600 Y BCAP29 n/a
5 TRCN0000369967 TAGGTCTCAAAGAAATCTTTA pLKO_005 364 3UTR 100% 13.200 6.600 Y BCAP29 n/a
6 TRCN0000060447 CCTTACCATTATCATCCTATT pLKO.1 226 3UTR 100% 10.800 5.400 Y BCAP29 n/a
7 TRCN0000060446 CTCCTGAAAGAACACTCTGAA pLKO.1 734 3UTR 100% 4.950 2.475 Y BCAP29 n/a
8 TRCN0000060444 GCTGTGAGAGAAGTAAGGAAA pLKO.1 266 3UTR 100% 4.950 2.475 Y BCAP29 n/a
9 TRCN0000060443 CGCTTATTACTCAACTGGCAA pLKO.1 435 3UTR 100% 2.640 1.320 Y BCAP29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03690 pDONR223 100% 27% None (many diffs) n/a
2 ccsbBroad304_03690 pLX_304 0% 27% V5 (many diffs) n/a
3 TRCN0000470082 CCGCTTAGATTACGTTGGCCCAAG pLX_317 63.7% 27% V5 (many diffs) n/a
Download CSV