Transcript: Human NR_163972.1

Homo sapiens NFKB repressing factor (NKRF), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
NKRF (55922)
Length:
3903
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163972.1
NBCI Gene record:
NKRF (55922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244905 CGTTGTATTCAGGCGTGTAAG pLKO_005 1422 3UTR 100% 10.800 15.120 N NKRF n/a
2 TRCN0000244907 GAACGACACAGCTCAGTTTAA pLKO_005 2174 3UTR 100% 13.200 10.560 N NKRF n/a
3 TRCN0000016428 GCGGAAATTCAAGCATACATT pLKO.1 1661 3UTR 100% 5.625 4.500 N NKRF n/a
4 TRCN0000016432 CCAAGAGACATCTACCAAGAT pLKO.1 1086 3UTR 100% 4.950 3.960 N NKRF n/a
5 TRCN0000244908 GGATGTAGAGAGGGTGAATAA pLKO_005 2588 3UTR 100% 13.200 9.240 N NKRF n/a
6 TRCN0000244906 TGATGCAATTGGTATCCTTAA pLKO_005 1850 3UTR 100% 10.800 7.560 N NKRF n/a
7 TRCN0000016430 CCTTAACAATTCTGCCTCATT pLKO.1 1865 3UTR 100% 4.950 3.465 N NKRF n/a
8 TRCN0000123966 CGGAAGGAAGACCTACTAGAT pLKO.1 2802 3UTR 100% 4.950 3.465 N Nkrf n/a
9 TRCN0000016431 GCCTTCACCATCACAGACATT pLKO.1 1274 3UTR 100% 4.950 3.465 N NKRF n/a
10 TRCN0000016429 GCTTGTGAAGTTAGATGCCAA pLKO.1 1530 3UTR 100% 2.640 1.848 N NKRF n/a
11 TRCN0000244909 TACCCTGAGAAATTATCATTT pLKO_005 3159 3UTR 100% 0.000 0.000 N NKRF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03682 pDONR223 100% 53% None 1_809del;2880_3903del n/a
2 ccsbBroad304_03682 pLX_304 0% 53% V5 1_809del;2880_3903del n/a
3 TRCN0000479332 AGTCTTGGGTAAGCCTTCCTAAAA pLX_317 19.7% 53% V5 1_809del;2880_3903del n/a
Download CSV