Transcript: Human NR_164073.1

Homo sapiens nicotinamide N-methyltransferase (NNMT), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
NNMT (4837)
Length:
2073
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_164073.1
NBCI Gene record:
NNMT (4837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_164073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035224 GCTCAAGAGCAGCTACTACAT pLKO.1 813 3UTR 100% 4.950 3.465 N NNMT n/a
2 TRCN0000315816 GCTCAAGAGCAGCTACTACAT pLKO_005 813 3UTR 100% 4.950 3.465 N NNMT n/a
3 TRCN0000035225 GTGACCTATGTGTGTGATCTT pLKO.1 550 3UTR 100% 4.950 3.465 N NNMT n/a
4 TRCN0000035226 CCTCTCTGCTTGTGAATCCTT pLKO.1 432 3UTR 100% 3.000 2.100 N NNMT n/a
5 TRCN0000315817 CCTCTCTGCTTGTGAATCCTT pLKO_005 432 3UTR 100% 3.000 2.100 N NNMT n/a
6 TRCN0000035228 TGGCTACACAATCGAATGGTT pLKO.1 903 3UTR 100% 3.000 2.100 N NNMT n/a
7 TRCN0000315815 TGGCTACACAATCGAATGGTT pLKO_005 903 3UTR 100% 3.000 2.100 N NNMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_164073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06646 pDONR223 100% 35.1% None (many diffs) n/a
2 ccsbBroad304_06646 pLX_304 0% 35.1% V5 (many diffs) n/a
3 TRCN0000468383 CCCCTCCCAATTCCCCGTTAGACG pLX_317 55.5% 35.1% V5 (many diffs) n/a
Download CSV