Transcript: Human NR_164113.1

Homo sapiens chromosome 10 open reading frame 25 (C10orf25), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
C10orf25 (220979)
Length:
2993
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_164113.1
NBCI Gene record:
C10orf25 (220979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_164113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147142 CCGTAAGAGATAGGAATTGTT pLKO.1 2465 3UTR 100% 5.625 7.875 N C10orf25 n/a
2 TRCN0000149582 GCCTGAAGTAATACAGTGGTT pLKO.1 1184 3UTR 100% 2.640 2.112 N C10orf25 n/a
3 TRCN0000129090 GCCAGAGGTATGTCAACTAAA pLKO.1 1715 3UTR 100% 13.200 9.240 N C10orf25 n/a
4 TRCN0000149973 CAAGGCTCAGAGAAGAAATGT pLKO.1 238 3UTR 100% 5.625 3.938 N C10orf25 n/a
5 TRCN0000148533 CCAACCTAGAAACTGCATACT pLKO.1 102 3UTR 100% 4.950 3.465 N C10orf25 n/a
6 TRCN0000129635 CCTGAAGTAATACAGTGGTTT pLKO.1 1185 3UTR 100% 4.950 3.465 N C10orf25 n/a
7 TRCN0000129498 GAGAAGAAATGTGCTCCGTTC pLKO.1 247 3UTR 100% 2.250 1.575 N C10orf25 n/a
8 TRCN0000131154 GAACCAAGGCTCAGAGAAGAA pLKO.1 234 3UTR 100% 4.950 2.970 N C10orf25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_164113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09863 pDONR223 100% 10.1% None 0_1ins56;132T>A;311_2993del n/a
2 ccsbBroad304_09863 pLX_304 0% 10.1% V5 0_1ins56;132T>A;311_2993del n/a
3 TRCN0000468645 ATTAGCCTTACCTCTTTATTACTT pLX_317 91.5% 10.1% V5 0_1ins56;132T>A;311_2993del n/a
Download CSV