Transcript: Mouse NM_021369.2

Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 6 (Chrna6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Chrna6 (11440)
Length:
2921
CDS:
243..1727

Additional Resources:

NCBI RefSeq record:
NM_021369.2
NBCI Gene record:
Chrna6 (11440)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103015 CGTGGAGGAATCAGTCTCTAA pLKO.1 2561 3UTR 100% 4.950 3.960 N Chrna6 n/a
2 TRCN0000103018 GACTTATGACAAGGCAGAAAT pLKO.1 779 CDS 100% 13.200 9.240 N Chrna6 n/a
3 TRCN0000103017 CCTTCTCATCATTGGCTCTAA pLKO.1 803 CDS 100% 4.950 3.465 N Chrna6 n/a
4 TRCN0000103019 GTGGCGAGAAAGTGACTCTTT pLKO.1 1045 CDS 100% 4.950 3.465 N Chrna6 n/a
5 TRCN0000103016 CCGGTTTATGTCTGTGGCTAT pLKO.1 277 CDS 100% 4.050 2.835 N Chrna6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021369.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02056 pDONR223 100% 81.4% 85% None (many diffs) n/a
2 ccsbBroad304_02056 pLX_304 0% 81.4% 85% V5 (many diffs) n/a
3 TRCN0000469017 ATCCTTGAAAAAGATCTAACTGGC pLX_317 26.1% 81.4% 85% V5 (many diffs) n/a
Download CSV