Transcript: Mouse NM_010910.1

Mus musculus neurofilament, light polypeptide (Nefl), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nefl (18039)
Length:
2014
CDS:
80..1711

Additional Resources:

NCBI RefSeq record:
NM_010910.1
NBCI Gene record:
Nefl (18039)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089720 CTCAAGTCTATCCGCACACAA pLKO.1 326 CDS 100% 4.950 6.930 N Nefl n/a
2 TRCN0000089719 GAGACCATTGAGGCTACGAAA pLKO.1 1448 CDS 100% 4.950 3.960 N Nefl n/a
3 TRCN0000089721 CTTGATGTCTGCTCGCTCTTT pLKO.1 1378 CDS 100% 4.950 3.465 N Nefl n/a
4 TRCN0000089718 CCAGTTGAGTTCCAGATCCTA pLKO.1 1775 3UTR 100% 3.000 2.100 N Nefl n/a
5 TRCN0000089722 CCGTTCTGCTTACAGTGGCTT pLKO.1 1342 CDS 100% 2.640 1.848 N Nefl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10993 pDONR223 100% 47.3% 51.1% None (many diffs) n/a
2 ccsbBroad304_10993 pLX_304 0% 47.3% 51.1% V5 (many diffs) n/a
3 TRCN0000470653 GTTCATTCAGCCAGTCCCTTCGAA pLX_317 53.5% 47.3% 51.1% V5 (many diffs) n/a
Download CSV