Transcript: Mouse NM_172608.1

Mus musculus transmembrane protein 184b (Tmem184b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmem184b (223693)
Length:
3388
CDS:
178..1401

Additional Resources:

NCBI RefSeq record:
NM_172608.1
NBCI Gene record:
Tmem184b (223693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252912 TTGGACCAGAAACTCGCATAT pLKO_005 1501 3UTR 100% 10.800 15.120 N Tmem184b n/a
2 TRCN0000173818 CAGCCTCAAAGAGACCATGAA pLKO.1 1191 CDS 100% 4.950 6.930 N Tmem184b n/a
3 TRCN0000194619 GTACCTCTACGTGACCATCAT pLKO.1 807 CDS 100% 0.000 0.000 N Tmem184b n/a
4 TRCN0000252913 ACCATGAACCCACACGATATT pLKO_005 1204 CDS 100% 13.200 9.240 N Tmem184b n/a
5 TRCN0000252911 ATGGCCGTCAGCACCGTTATA pLKO_005 736 CDS 100% 13.200 9.240 N Tmem184b n/a
6 TRCN0000252914 ATGGTCAAGTCCGTCATATTC pLKO_005 928 CDS 100% 13.200 9.240 N Tmem184b n/a
7 TRCN0000175236 CGTTCTTTCTTCCCATTCTTT pLKO.1 3066 3UTR 100% 5.625 3.938 N Tmem184b n/a
8 TRCN0000153494 CGTGACCATCATCTACAACAT pLKO.1 816 CDS 100% 4.950 3.465 N TMEM184B n/a
9 TRCN0000156742 GTTCTTCATGGTCAAGTCCGT pLKO.1 921 CDS 100% 0.660 0.462 N TMEM184B n/a
10 TRCN0000252915 TGAGGCCTTTGTCATCTATAA pLKO_005 531 CDS 100% 13.200 7.920 N Tmem184b n/a
11 TRCN0000153824 CCTCAAGTTCTTCATGGTCAA pLKO.1 915 CDS 100% 4.050 2.430 N TMEM184B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02867 pDONR223 100% 91% 96% None (many diffs) n/a
2 ccsbBroad304_02867 pLX_304 0% 91% 96% V5 (many diffs) n/a
3 TRCN0000473765 TGCTATGCCCGCCGTCACCCCTTT pLX_317 33.1% 91% 96% V5 (many diffs) n/a
Download CSV