Transcript: Mouse NM_030719.3

Mus musculus GATS protein-like 2 (Gatsl2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gatsl2 (80909)
Length:
4807
CDS:
292..1281

Additional Resources:

NCBI RefSeq record:
NM_030719.3
NBCI Gene record:
Gatsl2 (80909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250432 ACCAGAACATCTCCGTGTTTA pLKO_005 617 CDS 100% 13.200 10.560 N Gatsl2 n/a
2 TRCN0000250433 TGTATTGTACACACCTATAAA pLKO_005 3201 3UTR 100% 15.000 10.500 N Gatsl2 n/a
3 TRCN0000250431 GCAGACATCCCAGCATATTAC pLKO_005 1165 CDS 100% 13.200 9.240 N Gatsl2 n/a
4 TRCN0000250429 AGTCAAGCAGGGAAGCATTAG pLKO_005 1261 CDS 100% 10.800 7.560 N Gatsl2 n/a
5 TRCN0000250430 GTTCCCGAGTCACTTGCTATT pLKO_005 1038 CDS 100% 10.800 7.560 N Gatsl2 n/a
6 TRCN0000201177 GACTACACCATCATCGTAGAT pLKO.1 439 CDS 100% 4.950 3.465 N Gatsl2 n/a
7 TRCN0000191855 GATGTGATGTTCTACTCCAAT pLKO.1 904 CDS 100% 4.950 3.465 N Gatsl2 n/a
8 TRCN0000201489 CGTGTTTATGCTGTCCACCTA pLKO.1 630 CDS 100% 2.640 1.848 N Gatsl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030719.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13623 pDONR223 100% 39.7% 33.9% None (many diffs) n/a
2 ccsbBroad304_13623 pLX_304 0% 39.7% 33.9% V5 (many diffs) n/a
3 TRCN0000477107 CCCCAGACCGATGGGTCGTTCCAT pLX_317 67.1% 39.7% 33.9% V5 (many diffs) n/a
Download CSV