Transcript: Human NM_033544.2

Homo sapiens RCC1 domain containing 1 (RCCD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
RCCD1 (91433)
Length:
2774
CDS:
281..1411

Additional Resources:

NCBI RefSeq record:
NM_033544.2
NBCI Gene record:
RCCD1 (91433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045305 GCTCAGATGCAGTCAAGGCCA pLKO.1 1176 CDS 100% 0.220 0.176 N RCCD1 n/a
2 TRCN0000045307 GAACTGAATGAAGATGGTTCT pLKO.1 1064 CDS 100% 4.050 2.835 N RCCD1 n/a
3 TRCN0000045306 GAGCCATTGTGGGCCCAGAAT pLKO.1 602 CDS 100% 1.650 1.155 N RCCD1 n/a
4 TRCN0000045304 GCCACGGCTGTTGGAGGCGTT pLKO.1 880 CDS 100% 0.000 0.000 N RCCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04544 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04544 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477141 GGAGAACCTTTACATCTGCAATCC pLX_317 32.5% 100% 100% V5 n/a
Download CSV