Transcript: Mouse NM_029763.3

Mus musculus polymerase (RNA) III (DNA directed) polypeptide F (Polr3f), mRNA.

Source:
NCBI, updated 2019-02-17
Taxon:
Mus musculus (mouse)
Gene:
Polr3f (70408)
Length:
4160
CDS:
120..1070

Additional Resources:

NCBI RefSeq record:
NM_029763.3
NBCI Gene record:
Polr3f (70408)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111339 CAGGCCTCTTATATAGAATAA pLKO.1 328 CDS 100% 13.200 18.480 N Polr3f n/a
2 TRCN0000111337 TCAGAACGAAATGCCTCACAT pLKO.1 233 CDS 100% 4.950 3.960 N Polr3f n/a
3 TRCN0000111336 CAGAACGAAATGCCTCACATT pLKO.1 234 CDS 100% 4.950 3.465 N Polr3f n/a
4 TRCN0000111338 GTCTATCAAATCATAGAGGAT pLKO.1 402 CDS 100% 0.264 0.185 N Polr3f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07654 pDONR223 100% 90.5% 98.4% None (many diffs) n/a
2 ccsbBroad304_07654 pLX_304 0% 90.5% 98.4% V5 (many diffs) n/a
3 TRCN0000472647 CCACCGCACTCGCGAAACTTGGGA pLX_317 47.8% 90.5% 98.4% V5 (many diffs) n/a
Download CSV