Transcript: Mouse NM_001038614.1

Mus musculus olfactomedin 1 (Olfm1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Olfm1 (56177)
Length:
1007
CDS:
305..682

Additional Resources:

NCBI RefSeq record:
NM_001038614.1
NBCI Gene record:
Olfm1 (56177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235054 GCAGTTCAAGGGCTAACTTAA pLKO_005 667 CDS 100% 13.200 9.240 N Olfm1 n/a
2 TRCN0000235055 TTCACTAAGGAGCCTTGAATC pLKO_005 804 3UTR 100% 10.800 7.560 N Olfm1 n/a
3 TRCN0000235053 AGACCTGCAGTACGTGGAGAA pLKO_005 571 CDS 100% 4.050 2.835 N Olfm1 n/a
4 TRCN0000235052 GAAGTCTTGGACAGGCGAACT pLKO_005 545 CDS 100% 4.050 2.835 N Olfm1 n/a
5 TRCN0000063759 GTGGAGAAGATGGAGAACCAA pLKO.1 584 CDS 100% 3.000 2.100 N OLFM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07608 pDONR223 100% 24.8% 25.4% None (many diffs) n/a
2 ccsbBroad304_07608 pLX_304 0% 24.8% 25.4% V5 (many diffs) n/a
3 TRCN0000480645 TGAGCCACATTTCAACCATACGGA pLX_317 28.8% 24.8% 25.4% V5 (many diffs) n/a
Download CSV