Transcript: Human NM_201516.2

Homo sapiens H2A.Z variant histone 2 (H2AZ2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H2AZ2 (94239)
Length:
1299
CDS:
156..356

Additional Resources:

NCBI RefSeq record:
NM_201516.2
NBCI Gene record:
H2AZ2 (94239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303449 TGATCCCTCACATCCACAAAT pLKO_005 354 CDS 100% 13.200 10.560 N H2AZ2 n/a
2 TRCN0000303450 TGCTTAGAGGGATGCTTTAAC pLKO_005 406 3UTR 100% 13.200 10.560 N H2AZ2 n/a
3 TRCN0000106835 CCTGCCAATTAAATCATGATA pLKO.1 889 3UTR 100% 5.625 4.500 N H2AZ2 n/a
4 TRCN0000303448 ATGATTGATACCATGGTATAT pLKO_005 810 3UTR 100% 13.200 9.240 N H2AZ2 n/a
5 TRCN0000106839 GATTGGAAAGAAGGGACAGCA pLKO.1 379 3UTR 100% 2.640 1.848 N H2AZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04620 pDONR223 100% 51.5% 51.5% None 198_199ins186 n/a
2 ccsbBroad304_04620 pLX_304 0% 51.5% 51.5% V5 (not translated due to frame shift) 198_199ins186 n/a
3 TRCN0000470909 TCCATAAACAGCCGTATAATACCA pLX_317 70.4% 51.5% 51.5% V5 (not translated due to frame shift) 198_199ins186 n/a
Download CSV