Transcript: Human NM_001077262.1

Homo sapiens UBX domain protein 11 (UBXN11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
UBXN11 (91544)
Length:
1384
CDS:
149..1351

Additional Resources:

NCBI RefSeq record:
NM_001077262.1
NBCI Gene record:
UBXN11 (91544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437523 ACCCTCTACCAGGACGATACA pLKO_005 1127 CDS 100% 4.950 6.930 N UBXN11 n/a
2 TRCN0000173105 CCAGGATGACTGCTGAGAAAT pLKO.1 765 CDS 100% 13.200 9.240 N UBXN11 n/a
3 TRCN0000437839 CCCGAAGTCCAGCCTGAAATT pLKO_005 1210 CDS 100% 13.200 9.240 N UBXN11 n/a
4 TRCN0000172243 CCTCTGCCTTTGAGATCTTCA pLKO.1 1092 CDS 100% 4.950 3.465 N UBXN11 n/a
5 TRCN0000168293 GACATATTGGATGGCTTCTTT pLKO.1 575 CDS 100% 5.625 3.375 N UBXN11 n/a
6 TRCN0000172745 GAGGTGGACATGTTGAGTGAT pLKO.1 254 CDS 100% 4.950 2.970 N UBXN11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12962 pDONR223 100% 37.7% 32% None (many diffs) n/a
2 ccsbBroad304_12962 pLX_304 0% 37.7% 32% V5 (many diffs) n/a
3 TRCN0000471565 TCAAAACGATCCGCTGCTTAATCA pLX_317 38.2% 37.7% 32% V5 (many diffs) n/a
Download CSV