Transcript: Mouse NM_001081295.1

Mus musculus Rho guanine nucleotide exchange factor (GEF) 26 (Arhgef26), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Arhgef26 (622434)
Length:
5205
CDS:
721..3330

Additional Resources:

NCBI RefSeq record:
NM_001081295.1
NBCI Gene record:
Arhgef26 (622434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269354 ATACCCATTTGGAGCTATAAA pLKO_005 4801 3UTR 100% 15.000 21.000 N Arhgef26 n/a
2 TRCN0000269384 GATGATGTACACGATTAATTC pLKO_005 2607 CDS 100% 13.200 18.480 N Arhgef26 n/a
3 TRCN0000269338 ATGGGAAAGCAGCAGATTATC pLKO_005 1447 CDS 100% 13.200 9.240 N Arhgef26 n/a
4 TRCN0000284000 TAGCAACCAACCCGTCCTTTA pLKO_005 2354 CDS 100% 10.800 7.560 N Arhgef26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11806 pDONR223 100% 31% 33.2% None (many diffs) n/a
2 ccsbBroad304_11806 pLX_304 0% 31% 33.2% V5 (many diffs) n/a
3 TRCN0000474724 GTCAACTGGGGCATCTGGCACCTC pLX_317 44% 31% 33.2% V5 (many diffs) n/a
Download CSV