Transcript: Mouse NM_027294.2

Mus musculus CKLF-like MARVEL transmembrane domain containing 8 (Cmtm8), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cmtm8 (70031)
Length:
1064
CDS:
226..747

Additional Resources:

NCBI RefSeq record:
NM_027294.2
NBCI Gene record:
Cmtm8 (70031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104920 CCAGAACGAATCCCACTGTTA pLKO.1 782 3UTR 100% 4.950 3.960 N Cmtm8 n/a
2 TRCN0000104923 TGGAAACACGTACTTCAGTTT pLKO.1 696 CDS 100% 4.950 3.960 N Cmtm8 n/a
3 TRCN0000104922 CTATGCTGGAAACACGTACTT pLKO.1 690 CDS 100% 4.950 3.465 N Cmtm8 n/a
4 TRCN0000164561 CTCACCGTCTTCTTCCTCATT pLKO.1 472 CDS 100% 4.950 3.465 N CMTM8 n/a
5 TRCN0000104924 GTGCTTTAATGGCAGTGCCTT pLKO.1 552 CDS 100% 2.640 1.848 N Cmtm8 n/a
6 TRCN0000104921 ACCCTGACTTACACCAGGATT pLKO.1 502 CDS 100% 4.950 2.970 N Cmtm8 n/a
7 TRCN0000241573 CACCGTCTTCTTCCTCATTAT pLKO_005 474 CDS 100% 13.200 9.240 N CMTM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09682 pDONR223 100% 86.3% 91.3% None (many diffs) n/a
2 ccsbBroad304_09682 pLX_304 0% 86.3% 91.3% V5 (many diffs) n/a
3 TRCN0000467687 AATCACCCGCAGAAGCTTTCGACG pLX_317 81% 86.3% 91.3% V5 (many diffs) n/a
Download CSV