Transcript: Mouse NM_172512.2

Mus musculus GA repeat binding protein, beta 2 (Gabpb2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gabpb2 (213054)
Length:
8606
CDS:
442..1686

Additional Resources:

NCBI RefSeq record:
NM_172512.2
NBCI Gene record:
Gabpb2 (213054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055017 CGTCGAGTTACTTATCAAATA pLKO.1 798 CDS 100% 13.200 18.480 N Gabpb2 n/a
2 TRCN0000429840 GGTTGCAGAGGAGACAATAAT pLKO_005 1272 CDS 100% 15.000 12.000 N Gabpb2 n/a
3 TRCN0000055014 GCCAGCCATTTATTGTAACTA pLKO.1 1211 CDS 100% 5.625 4.500 N Gabpb2 n/a
4 TRCN0000433985 ACTTGTGCTCACTCATCATAT pLKO_005 1701 3UTR 100% 13.200 9.240 N Gabpb2 n/a
5 TRCN0000420677 GACAAACAGGGTTGAGGAAAT pLKO_005 1356 CDS 100% 10.800 7.560 N Gabpb2 n/a
6 TRCN0000055015 CCTCAGCTCATTTAGAAGAAA pLKO.1 1058 CDS 100% 5.625 3.938 N Gabpb2 n/a
7 TRCN0000434442 TGGAGTCCCTCTGGGTAACAT pLKO_005 1161 CDS 100% 5.625 3.938 N Gabpb2 n/a
8 TRCN0000415292 AGTTGATGTCACCGTAGTTGA pLKO_005 1536 CDS 100% 4.950 3.465 N Gabpb2 n/a
9 TRCN0000055016 CCTCACACTAACGTTTCCATA pLKO.1 1648 CDS 100% 4.950 3.465 N Gabpb2 n/a
10 TRCN0000055013 GCACACAAGTTCTCCCTAGTT pLKO.1 2144 3UTR 100% 4.950 3.465 N Gabpb2 n/a
11 TRCN0000438667 CATCGTGGAACTGCTTGTTAG pLKO_005 696 CDS 100% 10.800 6.480 N Gabpb2 n/a
12 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6407 3UTR 100% 4.050 2.025 Y Mtif2 n/a
13 TRCN0000010959 GCAATGCAGAATCAGGTGAAT pLKO.1 916 CDS 100% 4.950 3.465 N GABPB2 n/a
14 TRCN0000145323 GAAGATGAAGAAGAGGAAGAT pLKO.1 1294 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04817 pDONR223 100% 78.8% 77.4% None (many diffs) n/a
2 ccsbBroad304_04817 pLX_304 0% 78.8% 77.4% V5 (many diffs) n/a
3 TRCN0000467065 CAGCGACGATACGTCTCCGCGCAG pLX_317 30.4% 78.8% 77.4% V5 (many diffs) n/a
Download CSV