Transcript: Mouse NM_023343.2

Mus musculus integrin-linked kinase-associated serine/threonine phosphatase 2C (Ilkap), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ilkap (67444)
Length:
1368
CDS:
79..1257

Additional Resources:

NCBI RefSeq record:
NM_023343.2
NBCI Gene record:
Ilkap (67444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081422 GCAATCCTGTGTCGATATAAT pLKO.1 793 CDS 100% 15.000 21.000 N Ilkap n/a
2 TRCN0000081421 GCACCAGAACTTAATCAGGAA pLKO.1 579 CDS 100% 2.640 3.696 N Ilkap n/a
3 TRCN0000366417 GGAATACGAGCCTCGAAATTT pLKO_005 544 CDS 100% 15.000 10.500 N Ilkap n/a
4 TRCN0000366416 GGCAATCCTGTGTCGATATAA pLKO_005 792 CDS 100% 15.000 10.500 N Ilkap n/a
5 TRCN0000081419 CCAGAACTTAATCAGGAAATT pLKO.1 582 CDS 100% 13.200 9.240 N Ilkap n/a
6 TRCN0000375366 GGTCACATCTGTGCCTGATAT pLKO_005 984 CDS 100% 13.200 9.240 N Ilkap n/a
7 TRCN0000379290 TGTGGACAACATCCTGTATAT pLKO_005 750 CDS 100% 13.200 9.240 N Ilkap n/a
8 TRCN0000366418 CCATGTCATCCTGAACGATAT pLKO_005 450 CDS 100% 10.800 7.560 N Ilkap n/a
9 TRCN0000379222 TTACTCGGGTTTCATACTTTG pLKO_005 503 CDS 100% 10.800 7.560 N Ilkap n/a
10 TRCN0000081420 CCCATGTCATCCTGAACGATA pLKO.1 449 CDS 100% 4.950 3.465 N Ilkap n/a
11 TRCN0000081418 CCTTTACTCTTTGATGATCTT pLKO.1 211 CDS 100% 4.950 3.465 N Ilkap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023343.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04228 pDONR223 100% 89.2% 95.1% None (many diffs) n/a
2 ccsbBroad304_04228 pLX_304 0% 89.2% 95.1% V5 (many diffs) n/a
3 TRCN0000472884 GGGCGTGTACAGTAACTTCTGCAG pLX_317 45% 89.2% 95.1% V5 (many diffs) n/a
Download CSV