Construct: ORF TRCN0000472884
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010641.1_s317c1
- Derived from:
- ccsbBroadEn_04228
- DNA Barcode:
- GGGCGTGTACAGTAACTTCTGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ILKAP (80895)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472884
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80895 | ILKAP | ILK associated serine/threo... | NM_030768.3 | 100% | 100% | |
| 2 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_006712784.1 | 82.6% | 82.6% | 0_1ins204 |
| 3 | human | 80895 | ILKAP | ILK associated serine/threo... | XR_923033.1 | 74.3% | 1_149del;775_776ins88;1238_1375del | |
| 4 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_005246106.1 | 69.3% | 69.3% | 0_1ins360 |
| 5 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_017005056.2 | 69.3% | 69.3% | 0_1ins360 |
| 6 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_017005057.1 | 69.3% | 69.3% | 0_1ins360 |
| 7 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_024453162.1 | 69.3% | 69.3% | 0_1ins360 |
| 8 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_011511946.2 | 66.3% | 63.7% | 0_1ins259;29_30ins137 |
| 9 | human | 80895 | ILKAP | ILK associated serine/threo... | XM_017005058.1 | 66.3% | 63.7% | 0_1ins259;29_30ins137 |
| 10 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | NM_023343.2 | 89.2% | 95.1% | (many diffs) |
| 11 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529808.3 | 88% | 93.8% | (many diffs) |
| 12 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529809.3 | 86.3% | 91.5% | (many diffs) |
| 13 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529811.3 | 84.6% | 90.5% | (many diffs) |
| 14 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529812.3 | 83.3% | 89.2% | (many diffs) |
| 15 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529807.3 | 82.7% | 82.1% | (many diffs) |
| 16 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529810.3 | 82.2% | 83.6% | (many diffs) |
| 17 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529813.3 | 73% | 77.2% | (many diffs) |
| 18 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529814.2 | 61.7% | 67.8% | (many diffs) |
| 19 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529815.3 | 61.7% | 67.8% | (many diffs) |
| 20 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_011248065.2 | 61.7% | 67.8% | (many diffs) |
| 21 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_017322168.1 | 61.7% | 67.8% | (many diffs) |
| 22 | mouse | 67444 | Ilkap | integrin-linked kinase-asso... | XM_006529816.3 | 56% | 55.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cctcttcggg gacctgccgg agcccgagcg ctcgccgcgc ccggctgccg 121 ggaaagaagc tcagaaagga cccctgctct ttgatgacct ccctccggcc agcagtactg 181 actcaggatc agggggacct ttgctttttg atgatctccc acccgctagc agtggcgatt 241 caggttctct tgccacatca atatcccaga tggtaaagac tgaagggaaa ggagcaaaga 301 gaaaaacctc cgaggaagag aagaatggca gtgaagagct tgtggaaaag aaagtttgta 361 aagcctcttc ggtgatcttt ggtctgaagg gctatgtggc tgagcggaag ggtgagaggg 421 aggagatgca ggatgcccac gtcatcctga acgacatcac cgaggagtgt aggcccccat 481 cgtccctcat tactcgggtt tcatattttg ctgtttttga tggacatgga ggaattcgag 541 cctcaaaatt tgctgcacag aatttgcatc aaaacttaat cagaaaattt cctaaaggag 601 atgtaatcag tgtagagaaa accgtgaaga gatgcctttt ggacactttc aagcatactg 661 atgaagagtt ccttaaacaa gcttccagcc agaagcctgc ctggaaagat gggTCCACTG 721 CCACGTGTGT TCTGGCTGTA GACAACATTC TTTATATTGC CAACCTCGGA GATAGTCGGG 781 CAATCTTGTG TCGTTATAAT GAGGAGAGTC AAAAACATGC AGCCTTAAGC CTCAGCAAAG 841 AGCATAATCC AACTCAGTAT GAAGAGCGGA TGAGGATACA GAAGGCTGGA GGAAACGTCA 901 GGGATGGGCG TGTTTTGGGC GTGCTAGAGG TGTCACGCTC CATTGGGGAC GGGCAGTACA 961 AGCGCTGCGG TGTCACCTCT GTGCCCGACA TCAGACGCTG CCAGCTGACC CCCAATGACA 1021 GGTTCATTTT GTTGGCCTGT GATGGGCTCT TCAAGGTCTT TACCCCAGAA GAAGCCGTGA 1081 ACTTCATCTT GTCCTGTCTC GAGGATGAAA AGATCCAGAC CCGGGAAGGG AAGTCCGCAG 1141 CCGACGCCCG CTACGAAGCA GCCTGCAACA GGCTGGCCAA CAAGGCGGTG CAGCGGGGCT 1201 CGGCCGACAA CGTCACTGTG ATGGTGGTGC GGATAGGGCA CTGCCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGAGGG CGTGTACAGT AACTTCTGCA GACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t