Transcript: Mouse NM_133649.2

Mus musculus solute carrier family 12, member 6 (Slc12a6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc12a6 (107723)
Length:
6631
CDS:
509..3961

Additional Resources:

NCBI RefSeq record:
NM_133649.2
NBCI Gene record:
Slc12a6 (107723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313580 TCAACCGCATGGCCAACTATA pLKO_005 957 CDS 100% 13.200 18.480 N Slc12a6 n/a
2 TRCN0000069259 GCAGACCATTAAGCACCTAAT pLKO.1 2941 CDS 100% 10.800 15.120 N Slc12a6 n/a
3 TRCN0000317191 GCAGACCATTAAGCACCTAAT pLKO_005 2941 CDS 100% 10.800 15.120 N Slc12a6 n/a
4 TRCN0000069262 CGCGCTTGGAAGACTTTCATT pLKO.1 3119 CDS 100% 5.625 7.875 N Slc12a6 n/a
5 TRCN0000349513 CGCGCTTGGAAGACTTTCATT pLKO_005 3119 CDS 100% 5.625 7.875 N Slc12a6 n/a
6 TRCN0000069261 CCAAGGATAAATACATGGCAT pLKO.1 3657 CDS 100% 2.640 3.696 N Slc12a6 n/a
7 TRCN0000349917 AGGCCTCGATTCCGCTATTAT pLKO_005 2525 CDS 100% 15.000 10.500 N Slc12a6 n/a
8 TRCN0000313579 GGAAACAGGATACTGATATAT pLKO_005 4411 3UTR 100% 15.000 10.500 N Slc12a6 n/a
9 TRCN0000069260 CCATTGAAATCTTTCTGGTAT pLKO.1 1368 CDS 100% 4.950 3.465 N Slc12a6 n/a
10 TRCN0000069258 GCCAAGGAAATACTTGTGTAA pLKO.1 5156 3UTR 100% 4.950 3.465 N Slc12a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133649.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15687 pDONR223 0% 72.6% 78.4% None (many diffs) n/a
Download CSV