Transcript: Mouse NM_008047.5

Mus musculus follistatin-like 1 (Fstl1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fstl1 (14314)
Length:
3609
CDS:
99..1019

Additional Resources:

NCBI RefSeq record:
NM_008047.5
NBCI Gene record:
Fstl1 (14314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008047.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331350 AGGCCTGTGTGTGGCAGTAAT pLKO_005 279 CDS 100% 13.200 9.240 N FSTL1 n/a
2 TRCN0000419862 ATCCAAGATCCAGGTTGATTA pLKO_005 353 CDS 100% 13.200 9.240 N Fstl1 n/a
3 TRCN0000424607 CACCTGTAGGAATGCTTTAAG pLKO_005 1206 3UTR 100% 13.200 9.240 N Fstl1 n/a
4 TRCN0000012006 GAAGGTGAACACCAAAGAGAT pLKO.1 995 CDS 100% 4.950 3.465 N Fstl1 n/a
5 TRCN0000012004 GCAGAATGAAACAGCCATCAA pLKO.1 611 CDS 100% 4.950 3.465 N Fstl1 n/a
6 TRCN0000012003 GCAGGTTTGAATGAAGCCTTT pLKO.1 1296 3UTR 100% 4.050 2.835 N Fstl1 n/a
7 TRCN0000012005 CTCTGCATTGAGCAATGCAAA pLKO.1 249 CDS 100% 0.495 0.347 N Fstl1 n/a
8 TRCN0000012007 AGGCAGTAACTACAGTGAGAT pLKO.1 515 CDS 100% 4.950 2.970 N Fstl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008047.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02639 pDONR223 100% 88.9% 91.8% None (many diffs) n/a
2 ccsbBroad304_02639 pLX_304 0% 88.9% 91.8% V5 (many diffs) n/a
3 TRCN0000474964 GATGAGCTTCCTTTAGACCCCTGA pLX_317 45.5% 88.9% 91.8% V5 (many diffs) n/a
Download CSV