Transcript: Mouse NM_207667.3

Mus musculus fibroblast growth factor 14 (Fgf14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Fgf14 (14169)
Length:
3224
CDS:
411..1169

Additional Resources:

NCBI RefSeq record:
NM_207667.3
NBCI Gene record:
Fgf14 (14169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058626 GCCATTGGAAGTTGCCATGTA pLKO.1 1022 CDS 100% 4.950 3.960 N FGF14 n/a
2 TRCN0000436343 ATGGAATGCCCTACCAGATAT pLKO_005 1385 3UTR 100% 13.200 9.240 N FGF14 n/a
3 TRCN0000066989 CCAAGGATGACAGCACCAATT pLKO.1 706 CDS 100% 10.800 7.560 N Fgf14 n/a
4 TRCN0000066988 CCTTGCATGATGTTGGTGAAA pLKO.1 1054 CDS 100% 4.950 3.465 N Fgf14 n/a
5 TRCN0000066990 GCAAGTTTAAAGAGTCTGTTT pLKO.1 853 CDS 100% 4.950 3.465 N Fgf14 n/a
6 TRCN0000058623 GCAATAATGAATGGAGGCAAA pLKO.1 1122 CDS 100% 4.050 2.835 N FGF14 n/a
7 TRCN0000066991 ACCAGGTTATATTGCAGGCAA pLKO.1 642 CDS 100% 2.640 1.848 N Fgf14 n/a
8 TRCN0000066992 GCAAGGCTACTACTTGCAGAT pLKO.1 659 CDS 100% 0.405 0.284 N Fgf14 n/a
9 TRCN0000058627 CCTGAATGCAAGTTTAAAGAA pLKO.1 846 CDS 100% 5.625 3.375 N FGF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00560 pDONR223 100% 95.5% 98% None (many diffs) n/a
2 ccsbBroad304_00560 pLX_304 0% 95.5% 98% V5 (many diffs) n/a
3 TRCN0000478594 TCCGATACATCGCTTTAATTTGAC pLX_317 47.7% 95.5% 98% V5 (many diffs) n/a
Download CSV