Transcript: Mouse NM_177722.3

Mus musculus minichromosome maintenance domain containing 2 (Mcmdc2), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mcmdc2 (240697)
Length:
2553
CDS:
98..2143

Additional Resources:

NCBI RefSeq record:
NM_177722.3
NBCI Gene record:
Mcmdc2 (240697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283222 AGAATGATTCATGGCTATTAT pLKO_005 1775 CDS 100% 15.000 21.000 N Mcmdc2 n/a
2 TRCN0000264915 CTATCGGTTCAGTATTCTAAT pLKO_005 214 CDS 100% 13.200 10.560 N Mcmdc2 n/a
3 TRCN0000264914 GAGAAGACTGCTTGGATATTT pLKO_005 1116 CDS 100% 15.000 10.500 N Mcmdc2 n/a
4 TRCN0000264913 CTTTGTGAGTTTCCACTTAAT pLKO_005 440 CDS 100% 13.200 9.240 N Mcmdc2 n/a
5 TRCN0000264912 GATGTTCACAGTCAGCTATAG pLKO_005 2187 3UTR 100% 10.800 6.480 N Mcmdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 74.7% 73.8% None (many diffs) n/a
2 ccsbBroad304_13302 pLX_304 0% 74.7% 73.8% V5 (many diffs) n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 74.7% 73.8% V5 (many diffs) n/a
Download CSV