Transcript: Human NM_006695.4

Homo sapiens RUN domain containing 3A (RUNDC3A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
RUNDC3A (10900)
Length:
1879
CDS:
275..1492

Additional Resources:

NCBI RefSeq record:
NM_006695.4
NBCI Gene record:
RUNDC3A (10900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006695.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072904 CCTAAAGTTCACGCAGAGCTA pLKO.1 886 CDS 100% 2.640 2.112 N RUNDC3A n/a
2 TRCN0000072903 GTTCTCCCTATGCCTGAATAT pLKO.1 1582 3UTR 100% 13.200 9.240 N RUNDC3A n/a
3 TRCN0000072907 GAAGCGCATGTCAGAATACAT pLKO.1 679 CDS 100% 5.625 3.938 N RUNDC3A n/a
4 TRCN0000072905 CATCGAGAACATGGAGAACAT pLKO.1 607 CDS 100% 4.950 3.465 N RUNDC3A n/a
5 TRCN0000072906 TGTGAGCAGCATCGAGAACAT pLKO.1 598 CDS 100% 4.950 3.465 N RUNDC3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006695.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07701 pDONR223 100% 99.9% 100% None 729T>C n/a
2 ccsbBroad304_07701 pLX_304 0% 99.9% 100% V5 729T>C n/a
3 TRCN0000467002 GGTTATATTCTAATGCGACATACC pLX_317 35.8% 99.9% 100% V5 729T>C n/a
Download CSV