Transcript: Mouse NM_013847.4

Mus musculus glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) (Gcat), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gcat (26912)
Length:
2373
CDS:
61..1311

Additional Resources:

NCBI RefSeq record:
NM_013847.4
NBCI Gene record:
Gcat (26912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013847.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120408 GACTCAGTTCTACTCGATTTA pLKO.1 344 CDS 100% 13.200 18.480 N Gcat n/a
2 TRCN0000120410 GTATCTTTGTCATCGGATTTA pLKO.1 1160 CDS 100% 13.200 18.480 N Gcat n/a
3 TRCN0000314421 GTATCTTTGTCATCGGATTTA pLKO_005 1160 CDS 100% 13.200 18.480 N Gcat n/a
4 TRCN0000120409 TGGACTCAGTTCTACTCGATT pLKO.1 342 CDS 100% 4.950 3.960 N Gcat n/a
5 TRCN0000314482 TGGACTCAGTTCTACTCGATT pLKO_005 342 CDS 100% 4.950 3.960 N Gcat n/a
6 TRCN0000120411 AGAAGCCAAGATAGCCCACTT pLKO.1 396 CDS 100% 4.050 2.835 N Gcat n/a
7 TRCN0000314483 AGAAGCCAAGATAGCCCACTT pLKO_005 396 CDS 100% 4.050 2.835 N Gcat n/a
8 TRCN0000120407 CCCAGAAAGAAGAAAGCAGAT pLKO.1 1792 3UTR 100% 4.050 2.430 N Gcat n/a
9 TRCN0000314484 CCCAGAAAGAAGAAAGCAGAT pLKO_005 1792 3UTR 100% 4.050 2.430 N Gcat n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013847.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07887 pDONR223 100% 85.5% 90.2% None (many diffs) n/a
2 ccsbBroad304_07887 pLX_304 0% 85.5% 90.2% V5 (many diffs) n/a
3 TRCN0000479151 GGTATGAACATTTCTAGCAGCTAA pLX_317 25.3% 85.5% 90.2% V5 (many diffs) n/a
Download CSV